Skip to content

Mapping

Warning

Be sure to use the day1 Codespace you were using early when initiating VM for this practical.

Next-generation sequencing data is being produced at an ever-increasing rate. The raw data is not meaningful by itself and needs to be processed using various bioinformatic software. This practical will focus on genomic resequencing data where the raw data is aligned to a reference genome.

Introduction

Improvements in DNA sequencing technology have led to new opportunities for studying organisms at the genomic and transcriptomic levels. Applications include studies of genomic variation within species and gene identification. In this module we will concentrate on data generated using the Illumina Genome Analyzer II technology, although the techniques you will learn are applicable to other technologies (e. g. 454 GS FLX and ABI SOLiD). A single machine can produce around 20 Gigabases of sequence data in a week. This is the equivalent to over 6 human genomes. The data from the Illumina machine comes as relatively short stretches of 35 - 250 base pairs (bp) of DNA - around 300 million of them. These individual sequences are called reads. The older capillary sequencing technology generates longer reads of ~500 bp, but the approach is much slower and more expensive.

One of the greatest challenges of sequencing a genome is determining how to arrange sequencing reads into chromosomes. This process of determining how the reads fit together by looking for overlaps between them is called genome assembly. Capillary sequencing reads (~500bp) are considered a good length for genome assembly. Genome assembly using sequence reads of <100bp is more complicated due to the high frequency of repeats longer than the read length. Assemblies for bacterial genomes can comprise of at least 50 pieces (called “contigs”), whilst for Eukaryotes more than 1000 pieces is common. Therefore new sequencing technologies are applied predominantly where a reference genome already exists. A reference genome is a well assembled genome from the same or a similar organism that is undergoing sequencing. Sequencing a genome with new technology when there is an existing reference is called resequencing.

In this practical, we will focus on mapping reads to a reference genome and visualising the resulting alignments using IGV.

Sequencing/Mapping workflow

The diagram below describes the workflows for genomic resequencing and RNA sequencing. We will cover the in silico (computational) aspects of these workflows.

mapping_1

When resequencing, instead of assembling the reads to produce a new genome sequence and then comparing the two genome sequences, we map the new sequence data to the reference genome. We can then identify Single Nucleotide Polymorphisms (SNPs), insertions and deletions (indels) and Copy Number Variants (CNVs) between two similar organisms.

The first example we use here is a reference genome for Plasmodium falciparum (3D7 clone, size 23Mb, 81% AT content) (Gardener et al., 2002). This parasite is the causative agent of malaria. Malaria is widespread in tropical and subtropical regions, including parts of the Americas, Asia, and Africa. Each year, there are approximately 350–500 million cases of malaria, killing between one and three million people, the majority of whom are young children in sub-Saharan Africa. Recently we sequenced two laboratory strains, IT and DD2, using 76 bp paired end read technology. The second example is using the reference genome for Mycobacterium tuberculosis (H37Rv, size 4.4Mb, GC content 65.6%) (Cole et al, 1998). This bacterium causes tuberculosis disease.

Rather than attempting to assemble these very short reads into a whole new genome, we will map them against the existing genome assembly of P. falcipraum (3D7) or M. tuberculosis (H37Rv). Furthermore, we will identify differences between the genomes of the three clones, find mutations and CNVs associated to drug resistance, whilst determining how the reads fit together.

Here is the general workflow of mapping: 1. The paired end reads (F=forward; R=reverse) are mapped against the reference. Different tools can be used for that. The results can be transformed with samtools to an ordered and indexed bam file. 2. Those bam files can be read into programs like IGV to visualize the alignments of the short sequences. 3. From the bam file it is possible to call variants. The output format is BCF or VCF. VCF can be loaded easily into excel like tools.

Mapping_2

Quality control of the reads is always important, to correct for any GC content biases, possible contamination, and read quality.

Important

Before doing anything, we need to first activate the conda environment for this practical by typing the following: conda activate day1. This environment contains most of the software we need for this practical. This command needs to be run each time we open up a new terminal or switch from a different environment.

File formats

You have the P. falciparum 3D7 clone reference file (Pf3D7_05.fasta). This contains the assembled sequence of the 3D7 genome. You also have two files of sequence reads from the IT clone (IT.Chr5_1.fastq.gz and IT.Chr5_2.fastq.gz). Look in both the reference file and the read files.

FASTA format

In the terminal navigate to the data/malaria directory, by typing:

cd ~/data/malaria/
head -n 5 Pf3D7_05.fasta

Output

>Pf3D7_05
ctaaaccctgaaccctaaaccctgaaccctaaaccctaaaccctgaaccctaaaccctga
accctaaaccctgaaccccctaaaccctaaaccctgaaccctaaaccctaaaaccctgaa
ccctaaaccctgaaccctaaaccctgaaccctgaaccctaaaccctgaaccctaaaccct
gaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctgaac

The line starting with ">" defines the header and all subsequent lines define the sequence.

FASTQ format

Now type the commands below to see what FASTQ format looks like.

zcat IT.Chr5_1.fastq.gz | head -n 12

Output

@HS3_5961:1:2207:17088:52965#1/1
GCCGGTTGTTCGGCTGGAAGGTCCTTTTGCCCTTGGTCACGGGCGTCTCCTCGCTATGTCTGGCAACATCACCAT
+
GGGGGGEGFGFGGGFGDBEBF:AFDEFG?CFFDD:FBEE?EFEDFDEFEAEBFB8CCC?A@CD;ADDD86CCC><

Each read is represented by four lines:

  1. The read name and additional info from the sequencing platform
  2. The sequence of the read
  3. A row in which comments can be added (rarely used anymore)
  4. Sequence quality. There is one character for each nucleotide. The characters relate to a sequence quality score e.g. how likely is the nucleotide correct? ‘>’ is higher quality than ‘6’. Sequence reads tend to have more errors at the end than the start

Question

Which format allows the storage of base quality data?

FASTQ: the 4th line for each read in fastq format represents the sequence quality

Quality Control

Prior to the analysis of these sequences, it is highly advisable to perform quality control checks and filtering in order to minimise artefacts like base calling errors, poor quality reads or primer contamination. The difference in passing filtered data to downstream programs can be night-and-day for processes like de novo assembly or SNP calling.

FastQC is a tool written in Java to perform quality control checks on raw sequence data. It computes several statistics and shows the results on summary graphs and tables. We will analyse several datasets in order to check whether the samples look good or, on the contrary, they require further filtering.

First we will activate the software environment using:

conda activate day1

To use FastQC type the following in the terminal of your day1 environment:

fastqc ~/data/tb/sample1_1.fastq.gz
1. Download the html ~/data/tb/sample1_1_fastqc.html to your machine and open the html to view.

FastQC supports FASTQ files (all quality encoding variants), GZip compressed FastQ and alignment files (SAM and BAM formats).

Newly opened files will be immediately processed. Because of the size of FASTQ files it can sometimes take a couple of minutes to open them.

FastQC performs several analyses, described in modules on left hand side of the main window (see below). Note that these results should be taken as guidance in the context of our library and never as pass/fail results. Nevertheless, they will highlight major problematic aspects. Let us now interpret the output of some of the modules.

Normal results are marked with green ticks, slightly abnormal with orange exclamation marks and very unusual with red crosses

Information

The Basic Statistics module provides overall information such as the total number of reads, read length and %GC content.

This view shows the quality values (y-axis) along the read at each nucleotide position (x-axis). The greater this value, the lower the probability that the corresponding base call is incorrect. At each position a Box-Whisker plot is drawn where the central red line is the median; the yellow box represents the inter-quartile range (25-75%); the upper and lower whiskers the 10% and 90% points; and the blue line correspond to the mean quality. This analysis computes the mean quality of each read and then displays for all observed values the number of reads having such quality. It is expected that a small subset will have universally poor quality. FastQC outputs a warning if the most frequently observed mean is below 27 (corresponding to a 0.2% error rate) and a failure if is below 20 (1% error rate).

This graph will only appear in your analysis results if you're using an Illumina library which retains its original sequence identifiers. Encoded in these is the flowcell tile from which each read came. The graph allows you to look at the quality scores from each tile across all of your bases to see if there was a loss in quality associated with only one part of the flowcell.

The plot shows the deviation from the average quality for each tile. The colours are on a cold to hot scale, with cold colours being positions where the quality was at or above the average for that base in the run, and hotter colours indicate that a tile had worse qualities than other tiles for that base. In the example below you can see that certain tiles show consistently poor quality. A good plot should be blue all over.

This module outputs the percentage of N base calls at each position. N is usually called when the sequencer is not confident enough to call a base (A, T, C or G). Small proportion of Ns may appear especially towards the last positions.

Current sequencers frequently produce reads of uniform length. Nevertheless, if reads are trimmed due to quality issues we will observe variable read lengths.

This module computes the degree of duplication of every read in the file by looking for exact matches over the whole length of the rest of reads. A dataset with high depth of coverage, namely an over-represented target genome, will report higher duplication levels than one would expect since multiple reads starting at the same position will be found by chance.

In a normal library, every individual sequence will make up a tiny fraction of the whole set. Therefore, overrepresented reads may be indicators of biologically significant sequences or contaminants. All reads representing more than 0.1% of the total amount will be listed. Primers and adaptors are the most common sources of contamination.

Question

At this point you should be able to open sequence files with FastQC and interpret the quality plots described. First, open sample IT.Chr5_1.fastq.gz in ~/data/malaria/. Second, open sample1_1.fastq.gz, sample2_1.fastq.gz and sample3_1.fastq.gz in ~/data/tb/.

Questions:

Can you spot any quality issue with the reads we should be worried about? If so, what may be their source?

All of the FASTQ files look ok except sample3_1.fastq.gz. If you look at the 'Per base sequence quality' graph, you will see that many bases fall into the low quality zone (Q<20).

You may find useful the information in the following links:

  1. http://www.bioinformatics.babraham.ac.uk/projects/fastqc/
  2. http://bioinfo-core.org/index.php/9th_Discussion-28_October_2010
  3. http://www.youtube.com/watch?v=bz93ReOv87Y (FastQC video tutorial)

We have used the FastQC tool to identify problems in raw sequence data. Nevertheless, bad quality issues in our data are not a death sentence for the experiment; it can still be useful for downstream analyses if we applied the right filtering before processing. In general, the problem in the sequence files is the degradation in quality of bases at end of the reads, leading to the need to hard clip or trim them.

Trimming reads using Trimmomatic

The quality of the last few bases of the read can be substantially lower than the rest of the sequence read. In general, QC tools are unable to filter these reads out due to their overall high quality. Besides, it is not advisable to discard the whole read just because of few low-quality bases at the ends. Therefore, it is crucial to trim such bases before any further analysis. Trimmomatic (Lohse et al., 2012) is a fast command line tool that can be used to trim and crop Illumina data as well as to remove adapters (see Table below). We will be using the paired-end mode which will process both forward and reverse reads simultaneously, keeping the correspondence of read pairs intact.

Parameter Description
ILLUMINACLIP Cut adapter and other Illumina-specific sequences from the read
SLIDINGWINDOW Performs a sliding window trimming approach. It starts scanning at the 5' end and clips the read once the average quality within the window falls below a threshold
MAXINFO An adaptive quality trimmer which balances read length and error rate to maximise the value of each read
LEADING Cut bases off the start of a read, if below a threshold quality
TRAILING Cut bases off the end of a read, if below a threshold quality
CROP Cut the read to a specified length by removing bases from the end
HEADCROP Cut the specified number of bases from the start of the read
MINLEN Drop the read if it is below a specified length
AVGQUAL Drop the read if the average quality is below the specified level
TOPHRED33 Convert quality scores to Phred-33
TOPHRED64 Convert quality scores to Phred-64

Try to understand what the following command line specifies by looking at the Trimmomatic parameters in the previous table, and run it for sample1.

cd ~/data/tb/
trimmomatic PE sample1_1.fastq.gz sample1_2.fastq.gz -baseout sample1.fastq LEADING:3 TRAILING:3 SLIDINGWINDOW:4:20 MINLEN:36

Alignment of short reads

A major step in most sequence analysis pipelines involves the alignment of reads against a reference genome, a prequisite stage for downstream analyses. Traditional alignment software have become obsolete when dealing with the large amounts of short reads (millions) produced by NGS platforms and, during the last few years, software particularly designed to map short queries onto a long reference sequence have been produced.

Currently popular alignment tools are summarised in Li & Homer (2010). As shown in column 5 in the Table below, most of them allow gaps in alignments. Effective gapped aligners avoid calling false SNPs predicted due to the presence of insertions and deletions (indels). Furthermore, software including paired-end information are capable of mapping repeat reads with uniquely mapped mates; they also correct alignment errors that are inconsistent with the constraints imposed by mate pairs in terms of distance and orientation. Base quality in reads has also been exploited by programs like MAQ improving alignment accuracy.

All aforementioned programs output both aligned and unaligned reads in Sequence Alignment/Map (SAM) format (H. Li et al. 2009), a standardised format widely supported by downstream bioinformatic tools (e.g. variant callers, alignment viewers). The development and improvement of efficient short-read alignment algorithms has made the fast processing of data produced by current sequencing platforms feasible which, initially, entailed a bottleneck in the analysis of such high-coverage sequence datasets.

Sequence alignment Exercise 1

In this exercise we will be running the Burrows-Wheeler Aligner (BWA), an efficient program that aligns relatively short nucleotide sequences (i.e. short reads) against a long reference sequence. It implements two algorithms, bwa-short and BWA-SW. The former works for query sequences shorter than ~200bp with low error rate (<3%) (e.g. reads produced by Illumina technology). It performs gapped global alignment, supports paired-end reads, and is one the fastest short read alignment algorithms currently available. BWA-SW is designed for longer sequences (e.g. 454 reads) with more errors.

Open up a new terminal window and type bwa

All available BWA commands will appear on the terminal screen as shown below.

Output

Program: bwa (alignment via Burrows-Wheeler transformation)
Version: 0.7.17-r1188
Contact: Heng Li 

Usage:   bwa  [options]

Command: index         index sequences in the FASTA format
        mem           BWA-MEM algorithm
        fastmap       identify super-maximal exact matches
        pemerge       merge overlapping paired ends (EXPERIMENTAL)
        aln           gapped/ungapped alignment
        samse         generate alignment (single ended)
        sampe         generate alignment (paired ended)
        bwasw         BWA-SW for long queries

        shm           manage indices in shared memory
        fa2pac        convert FASTA to PAC format
        pac2bwt       generate BWT from PAC
        pac2bwtgen    alternative algorithm for generating BWT
        bwtupdate     update .bwt to the new format
        bwt2sa        generate SA from BWT and Occ

In order to map our paired-end reads, we will use ‘index’ and ‘mem’ commands. The ‘index’ command takes the reference genome (i.e. the database) in FASTA format as input and indexes it, which typically will take a few hours. This command only needs to be executed once for a particular reference genome.

To see all options for the index command type: bwa index

Most options will be set automatically according to the data we are running it on. Thus, we do not have to worry about setting them.

Type the following line:

bwa index ~/data/tb/tb.fasta

Several alignment algorithms are implemented in BWA. We will be using the BWA-MEM, which is the latest and generally recommended for high-quality queries as it is faster and more accurate. To see which parameters can be tuned for the ‘mem’ command type: bwa mem

We will be using the trimmed files output (from applying trimmomatic) as input for BWA:

bwa mem -R "@RG\tID:sample1\tSM:sample1\tPL:Illumina" ~/data/tb/tb.fasta sample1_1P.fastq sample1_2P.fastq | samtools view -b - | samtools sort -o sample1.bam -

Then we can index the bam file using:

samtools index sample1.bam

The previous commands transformed SAM files into binary format, sorted the reads by occurrence against the reference, and then indexed the bam files. At this point, we can use the ‘flagstat’ samtools command to print summary statistics from indexed bam files:

samtools flagstat sample1.bam
The 'flagstat' output should look like this:

Output

1345146 + 0 in total (QC-passed reads + QC-failed reads)
0 + 0 secondary
0 + 0 supplementary
0 + 0 duplicates
1330984 + 0 mapped (98.95% : N/A)
1345146 + 0 paired in sequencing
672573 + 0 read1
672573 + 0 read2
1312598 + 0 properly paired (97.58% : N/A)
1318846 + 0 with itself and mate mapped
12138 + 0 singletons (0.90% : N/A)
0 + 0 with mate mapped to a different chr
0 + 0 with mate mapped to a different chr (mapQ>=5)

Where each line specifies:

  1. Total number of reads
  2. Duplicates
  3. Number of mapped reads
  4. Paired reads in sequencing
  5. Number of forward reads
  6. Number of reverse reads
  7. Number of properly mapped reads (same chromosome, opposite orientation, and within few deviations from the expected insert size)
  8. Number of reads mapped along with their mates (7 is a subset of 8)
  9. Singletons: number of reads mapped alone, i.e. mate not mapped (8+9=3)
  10. Reads whose mates are mapped to a different chromosome
  11. Reads whose mates are mapped to a different chromosome with mapping quality greater than 5; note that (11) is a subset of (10)

Finally, let's also remove some temporary files we no longer need. Trimming has produced some files which are unzipped and take up a lot of space. Let's remove these using:

rm sample1_1P.fastq sample1_1U.fastq sample1_2P.fastq sample1_2U.fastq

Exercise

Execute all previous commands to get a bam file for sample 2

You need to run through the following steps:

  1. Trim the reads with trimmomatic
  2. Use bwa to align the reads and samtools to store as bam

Here is the code you need to use:

cd ~/data/tb
trimmomatic PE sample2_1.fastq.gz sample2_2.fastq.gz -baseout sample2.fastq LEADING:3 TRAILING:3 SLIDINGWINDOW:4:20 MINLEN:36
bwa mem -R "@RG\tID:sample2\tSM:sample2\tPL:Illumina" ~/data/tb/tb.fasta sample2_1P.fastq sample2_2P.fastq | samtools view -b - | samtools sort -o sample2.bam -
samtools index sample2.bam



Do Not Proceed Until Completing The Exercise Above For Sample 2



Viewing in IGV

Info

Integrative Genomics Viewer (IGV) is a high-performance visualization tool for interactive exploration of large, integrated genomic datasets. It supports a wide variety of data types, including array-based and next-generation sequence data, and genomic annotations.

Info

Graphical tools in this course should be started using the terminal, but we will need to view the interface using the virtual desktop. To do this, you need to make sure you have downloaded IGV already.

Launch IGV on your machine and perform the following steps:

  1. Download the following files from the side panel in vs code to your machine: tb.fasta, tb.fasta.fai, tb.gff, sample1.bam, sample1.bam.bai. Make sure they are saved within the same location. Note, if you cannot find the 'tb.fasta.fai' file simply run:
samtools faidx ~/data/tb/tb.fasta
  1. We first need to load the reference genome into IGV. To do this click on Genomes -> Load Genome from File.... Navigate to where you downloaded your files in Step 1 and select the tb.fasta file.
  2. You can also load the genes by clicking on File -> Load from File..., then selecting the tb.gff file.
  3. Finally you can load the bam file by clicking File -> Load from File... and selecting the bam file you wish to load, in our case it will be sample1.bam.

There is a lot going on on the screen so have a look at the image below which explains some of the most important features.

  1. Zoom controls: This controls the level of zoom. To see your alignments you will need to zoom in
  2. Search bar: Here you can specify the region you want to view using genomic coordinates in the form of Chromosome:start-end. You can also search by gene name.
  3. Coverage track: This displays when you have loaded a bam file and is a bargraph where each bar represents a genomic position and the high is determined by the number of reads aligning to that position. If you click on a bar it will open up a window telling you the number of ACTGs.
  4. Alignment track: Each grey bar represents a read. If there are coloured nucleotides, black dashes or purple vertical lines it represents a difference from the reference. Have a look at this document to find out more.
  5. Gene track: This shows the location and orientation of the genes. Click on a gene to find out more information.

Additionally, you can see that the screenshot above has loaded more than one bam file.

Zooming in and out

Now you will be able to view the alignment of the reads to the reference. By default, IGV will only display the alignments when viewing a region of the genome less than 30kb. To view the alignment you can zoom in using the "+" button on the top right side of the window. You can zoom out using the "-" button.

Viewing a region

You can zoom in to a specific region using the search bar. You can do this by entering your region using the specific format: chromosome_name:start-end. For example if you want to go zoom in on positions 1000-2000 on the Mtb chromosome you can type in "Chromosome:1000-2000" and hit Enter.

In most cases you'll probably be searching for a certain gene. You can also enter the gene name into the search bar and it will automatically center the view on this gene. Try this with the rpoB gene for example. Type in "rpoB" into the search bar and hit Enter.

Exercise: Mapping the P. falciparum IT reads with BWA

Info

Now we will map the IT clone reads to the 3D7 reference, again using the short reads mapping program BWA

The files for this exercise are in the ~/data/malaria directory:

cd ~/data/malaria/

First we need to index the reference (the algorithm needs to access specific positions in the reference in an efficient way). We will also index the fasta using 'samtools faidx' as the index needs to be in a slightly different format for loading into IGV.

bwa index ~/data/malaria/Pf3D7_05.fasta
samtools faidx ~/data/malaria/Pf3D7_05.fasta

Next, read files (both forward/reverse) are mapped against the reference

bwa mem ~/data/malaria/Pf3D7_05.fasta ~/data/malaria/IT.Chr5_1.fastq.gz ~/data/malaria/IT.Chr5_2.fastq.gz | samtools view -b - | samtools sort -o IT.Chr5.bam -

The details of where each IT clone read has been mapped is now stored in the file IT.Chr5.bam. We are going to view the mapped reads in IGV. Before we can proceed, however, we must index the BAM file to allow programs such as IGV quick access to different sections of the file.

samtools index IT.Chr5.bam

Before we visualize the alignment of the reads in IGV, let us have a look at the sam/bam format. Samtools was developed to have a standard format to store reads. It contains information about the reference sequence, where a read is mapped, quality of mapping, and where it’s mate is mapped. Files ending with .sam, are normally plain text, but as they might take too much space, the file is compressed into a bam file. All visualization tools will need the bam file. It has to be sorted (by chromosome and position) and indexed. Indexing enables the fast processing of alignments.

samtools view IT.Chr5.bam | grep "IL39_6014:8:61:7451:18170"

mapping_1

Exercise

Execute all previous commands for to get a bam file for the next sample DD2.Chr5

You need to run through the following steps:

  1. No need to index the reference (we already did this).
  2. Map the forward and reverse reads against the reference.
  3. Index the bam file.

Here is the code you need to use:

cd ~/data/malaria
bwa mem ~/data/malaria/Pf3D7_05.fasta ~/data/malaria/DD2.Chr5_1.fastq.gz ~/data/malaria/DD2.Chr5_2.fastq.gz | samtools view -b - | samtools sort -o DD2.Chr5.bam -
samtools index DD2.Chr5.bam

Viewing the mapped reads in IGV

We will now examine the read mapping in IGV using the BAM view feature.

We will need to download the Pf3D7_05.fasta, Pf3D7_05.fasta.fai, Pf3D7_05.gff, IT.Chr5.bam, and IT.Chr5.bam.bai.

Launch IGV. We first need to load the reference genome. To do this click on Genomes -> Load Genome from File.... Navigate to where you downloaded your files and select the Pf3D7_05.fasta file. You can also load the genes by clicking on File -> Load from File..., then selecting the Pf3D7_05.gff file. Finally you can load the bam file by clicking File -> Load from File... and selecting the bam file you wish to load, in our case it will be IT.Chr5.bam.

Question

Scroll through the genome. Describe the coverage. Are there regions that are not covered?

In general there is good coverage across the genome. This can be said by the fact that most of the positions have many reads overlapping them. There are a few positions with few or no reads aligning. This could be due to poor sequencing of those regions or a deletion.

Let's go to the region around the PF3D7_0504700 gene by typing it into the search bar and hitting Enter.

Zoom in and position the mouse over a read until a window pops up. This window provides information on the mapping of the reads, as it is stored in the bam file. Notice the Mapping quality (MAPQ). The maximum value for this is 60. The mapping quality depends on the accuracy of the sequence read and the number of mismatches with the reference. A value of 0 means that the read maps equally well to at least one other location and therefore is unreliably mapped.

Differences in read coverage

It is thought that a duplication in the mdr1 gene of P. falciparum is associated with drug resistance against the antimalarial mefloquine and that it may also modulate susceptibility to chloroquine, another antimalarial drug. For more information have a look in PubMed, e.g. at Borges et al. (2011) [PMID: 21709099] or at Mungthin et al. (2010) [PMID: 20449753]

Once IGV has started running on your screen navigate to the mdr1 gene locus using the search bar.

Question

It looks like that those two clones have a copy number variation (assuming the reference was assembled correctly). Is the duplication the same in both clones?

The region with elevated coverage is slightly different and so we can conclude that the duplication is different between the strains.

Identifying Single Nucleotide Polymorphisms

Let us have a look at SNPs now. To do so, zoom in on the mdr1 gene and make sure you are in Strand Stack view (double-click on the tracks and select 'Colour alignments by -> read strand') and have Show SNP marks (double-click on the tracks, select 'show mismatched based') selected. As mentioned before, in addition to true SNPs some differences between the reference sequence and the mapped reads are due to sequencing errors. On average, 1 in every 100 bases in the reads is expected to be incorrect. In particular, some sequencing errors may be due to a systematic problem as illustrated below.

Differently coloured nucleotides appear on the stacked reads highlighting every base in a read which does not match to the reference. If you zoom in you can distinguish real SNPs as vertical coloured lines, while the random sequencing errors are more disperse.

Question

When you zoom in on position 958145 as far as you can go, you can see the presence of two SNPs. Do both samples have the same variations? What is the consequence of this SNP? Can we tell what effect it will have for the clones (See e.g. Mula et al. (2011) [PMID: 21810256]). These SNPs are located in codon 86 of the MDR1 gene. To view location of codons, you can right click on the blue bar in the annotation section and select "Expanded".

You should see that both variants are located in the same codon. Sample IT has a SNP that changes the amino acid from a N to a Y (AAT codes for Asn (N) and TAT codes for Tyr (Y)). Sample DDT has two SNPs that change the codon from AAT (N) to TTT (F), however this is not the full story. It look like the SNP at position 958146 is not completely fixed in the sample (not all the reads containt the SNP). This means that this sample has both F and N at position 86. There is evidence that mutation N86Y may modulate the degree of resistance to chloroquine.

Information

Important aspects of the mapping procedure

Non-unique/repeat regions

A sequence read may map equally well to multiple locations in the reference genome. In such cases it is unclear where the read should be placed. Different mapping algorithms have alternative strategies for this problem. Maq will randomly report only one of the mapping locations and give the read a score of 0.

GC content

Some organisms have genomes with extreme GC content. The Plasmodium genome, for instance, is 19% GC, meaning 81% of bases are A or T. The result of this is that reads are more likely to map by chance to multiple locations in the genome, when compared to a genome with neutral GC content (e.g. 40-60% GC).

Insert size

When mapping paired reads, the mapping algorithm (e.g. bwa) takes the expected insert (e.g. sequenced DNA fragment) size into account. If the fragments are expected to be, on average 400bp and the sequence reads are 150bp, then the paired reads should be ~100bp apart. If the paired reads are significantly further apart then we can say that the reads do not map reliably and discard them. This information can assist with improving the reliability of mapping.

Tips

It is always a good idea to try different programs for any particular problem in computational biology. If they all produce the same answer you can be more certain it is correct. Alternative short read mappers include SOAP (Li et al., 2008b), Ssaha (Ning et al., 2001), MAQ (Li et al., 2008), Bowtie(2) (Langmead et al, 2009, 2012) and SMALT. As seen, TopHat (Trapnell et al., 2009) is particularly useful for RNAseq mapping as it supports spliced mapping. New tools for mapping sequence reads are continually being developed. This reflects improvements in mapping technology but it is also due to changes in the sequence data to be mapped. The sequencing machines we are using now (e.g. Illumina Genome Analyzer II, HiSeq2000/2500, 454 GS FLX etc) will not be the ones we are using in a few years time and the data the new machines produce are likely to be sub-optimally mapped with current tools.

This concludes the Mapping practical. You should now be able to:

  1. Assess the quality of raw sequence data
  2. Perform read trimming to remove low quality bases
  3. Map reads to a reference genome using BWA

Next up you will learn how to use the alignment you have generated to call variants.